• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention provides a polymerase chain reaction (PCR) kit to rapidly detect bovineand ovine/caprine-derived ingredients in one reaction. The PCR kit includes one pair of specific primers, reaction reagents and blank control, as well as positive controls of bovine and ovine/caprine. The “bovine” mentioned in the present invention includes cattle, zebu, yak and buffalo, and the “ovine/caprine” refers to various breeds of sheep and goat. The specific primers are a pair of primers that can amplify the DNA sequence of bovine (SEQ ID NO. 1) and ovine/caprine (SEQ ID NO.2) at the same time. In addition, the size of amplified fragment in bovine (125 bp) differs from that in ovine/caprine (107 bp). Thus, the bovine-derived ingredients could be effectively distinguished from ovine/caprine by detecting the size of amplified DNA fragments in one PCR reaction. The PCR kit can be applied to analyze and determine whether the samples contain bovine or ovine/caprine-derived ingredients. In conclusion, the present invention provides a rapid, sensitive, cost-effective reliable approach for the detection of bovine- and ovine/caprine-derived ingredients.
    公开号:NL2024167A
    申请号:NL2024167
    申请日:2019-11-06
    公开日:2019-12-02
    发明作者:Liu Bang；Wang Wenjun；Liu Zuhong；Zhou Xiang；Zhang Qingde
    申请人:Univ Huazhong Agricultural；
    IPC主号:
    专利说明:

    FIELD OF THE INVENTION
    The present invention relates to animal molecular biology. Specifically, the present invention further relates to a PCR kit containing one specific primer pairs which can simultaneously determine bovine and ovine/caprine-derived ingredients in one reaction.
    BACKGROUND OF THE INVENTION
    The detection of animal-derived ingredients (especially bovine, ovine and caprine) in food, feedstuff and health products is an important task of food supervision and market management department. To prevent, control and eradicate transmissible spongiform encephalopathies (TSE), the European Union (EU) has amended and passed the Decision (EU) 2017/622, which prohibits the import of bovine, ovine and caprine derived ingredient from the country or region exposing to TSE. Therefore, to crack down on illegal acts of food adulteration and ensure the safety of ruminant feedstuffs, it is of great significance to develop a technology for detection of the bovine-, ovine- and caprine-derived ingredients in food and feedstuffs.
    Although, several PCR assays have been documented for the identification of bovine, ovine and caprine in foods and feedstuffs (Table 1), there are still some technique disadvantages: (1) these methods require multiple primer pairs or fluorescent probes to identify bovine-, ovine- and caprine-derived ingredients, which make the assays complicated and costly; (2) the target species are limited to cattle, while other bovines (including yak, zebu and buffalo) cannot be detected simultaneously and equivalently, which may lead to false-negative results; (3) in the specificity test, only several particular species ( such as cattle, sheep, pig, chicken, duck and horse) are verified and identified, not including mouse, fox, raccoon dog, fish and plant species (especially for maize and soybean usually existing in feedstuffs), which makes the specificity of these methods arguable. Therefore, it is imperative to establish a method 5 to detect bovine- and ovine/caprine-derived ingredients in foods and feedstuffs, which could target to detect all bovine (cattle, yak, buffalo and zebu), ovine and caprine (sheep and goat), and then distinguish bovine from ovine/caprine based on the size of amplified fragments in one reaction. This convenient, fast, accurate and low-cost detection method is urgently needed for feed and food regulatory authorities, which can escort the authenticity and credibility of the feed and food industry.
    Table 1
    Identified speciesDetection methodTarget gene(s)Produc t size(bp)Species in specificty testDetection limitReferenceDNA contents (ng)Incorporatio n ratio (w/w, %)cattle, sheep and goatmultiplex PCRal2S rRNA84,121 and 122cattle, sheep, goat, chamois, deer, horse, pig, rabbit, chicken, duck, goose, turkey, cat, dog, rat, anchovy, salmon, maize, soybean, oat 0.10Martin et al.,2007cattlereal-time PCRmtDNA68avian, ovine, procine, bovine and fish meal, milk power and feather meal-0.10Marta et al.,2007ruminant, cattlereal-time PCRgenomic DNA83 and142-0.10cattlereal-time PCRmtDNA108-0.10bovine and caprineduplex real-time PCR16S rRNA, 12S rRNA96 and142pork, soybean, bovine, sheep, chicken and caprine-0.003% and0.005Safdar et al., 2014bovinereal-time PCR12S rRNA84cattle, sheep, goat, pig, chicken, turkey, duck, goose, horse, rabbit, cat, dog, rat anchovy, salmon, hake, grouper, sardine, tuna, barley, maize, oats, soybean, rye, and wheat0.010.10Martin et al.,2008
    bovine, ovine and caprinemultiplex PCRMitDNA, Mit. t.glu gene, cyt b and 12S rRNA271,119 and142bovine, ovine and caprine, quail, pheasant, ostrich, chicken, duck, pig and fish, cat, dog, buffalo, deer, horse, mouse, rabbit, rat and soy protein-0.01Safdar andJunejo, 2015bovineSYBR duplex real-time PCRMitDNA93pork, horse, soybean, bovine, sheep, chicken and turkey.-0.001Safdar andJunejo, 2015bovinePCR16S rRNA131cattle, pig, tilapia, and plant ingredients0.001-Lee et al., 2016
    SUMMARY
    With respects to the deficiency in the prior art, one object of the present invention is to provide a pair of specific primers for detecting and distinguishing bovine- and ovine/caprine-derived ingredients in one reaction.
    Furthermore, the second object of the present invention is to provide a PCR kit for detecting and distinguishing bovine and ovine/caprine-derived ingredients in food and feedstuffs.
    To achieve the above objects, the species-specific DNA sequences were screened based on the conservation of the intra-species, the specificity of the inter-species and the copy number of the target DNA sequence. The species-specific DNA sequences were tested using nuclear DNA of cattle, buffalo, sheep, goat, rat, mouse, hamster, guinea pig, horse, deer, donkey, pig, chicken, duck, goose, rabbit, fox, dog, mink, raccoon dog, fish, corn, and soybean. And then the specific DNA sequences which exists in the bovine, ovine and caprine rather than in the other species, or has low homology with the other species, were selected for the target DNA sequences. To further simplify the process of detection and reduce cost, the selected sequence should be able to differentiate bovine from ovine/caprine while ensuring the specificity. After enormous amount of analysis and experimental studies, the specific DNA sequences of TAF4 gene were finally selected for further detection. The nucleotide sequences of selected specific DNA sequences are shown as SEQ ID NO. 1 and SEQ ID NO.2. Based on the above process, the present invention first provides a specific primer pairs of bovine and ovine/caprine, which could specifically amplify the nucleotide sequence or the specific DNA fragment of the sequence shown as SEQ ID NO. 1 (bovine) and SEQ ID NO.2 (ovine/caprine). The size of amplified fragment is different between bovine (125 bp) and ovine/caprine (107 bp), which can be easily distinguished. The size of the primers are preferably 18-27 bp in size. The design of primer pair should consider the possibility of mismatch, the size of amplified fragment and the reaction temperature. The optimal primer pairs are shown as below:
    Forward primer: 5' - ATGGCTTAGGACCCAGCTCT -3Z ; and
    Reverse primer: 5Z - ACAR'CC AGAACCTGGATCGGA -3Z .
    1 Base R is a degenerate base A/G.
    The PCR kit provided in the present invention includes the specific primer pairs described as above. The PCR kit also includes one or more of the following reagents: Taq enzyme, dNTPs, MgCh, PCR buffer, DNA templates of positive controls (genomic DNAs of bovine and ovine/caprine) and blank control (sterile water).
    Moreover, the present invention also provides the PCR method of the bovine-specific and ovine/caprine-specific primer pairs or the PCR kit in the identification and differentiation of bovine- and ovine/caprine-derived ingredients in one PCR reaction.
    The above PCR method is described as follows:
    1) Extract genomic DNA from samples (Phenol-chloroform extraction method);
    2) PCR amplification with the specific primer pairs; the genomic DNAs of bovine and ovine/caprine were added to the PCR mixture as positive control, and the sterile water works as blank control. The reaction system of PCR is shown in Table 2.
    Table 2 The reaction system of PCR amplification in the present invention
    ReagentConcentrationAmountFinal concentrationTaq enzyme5 U/pL0.1 μΕ0.025 U/μΕPCR Buffer10x PCR Buffer2 μΕ1χ PCR BufferdNTP Mixture2.5 niM per base1.6 μΕ0.2 inM per baseForward primer10 μΜ0.4 μΕ0.2 μΜReverse primer10 μΜ0.4 μΕ0.2 μΜ
    DNA template 50-100 ng/pL 2.0 pL — sterile water 13.5 pL
    Total volume 20.0 pL
    3) The procedure of PCR: An initial heat denaturation step at 95 °C for 5 min, followed by 35 cycles consisting of 95 °C for 30 s (DNA denaturation), 62 °C for 30 s (primer pairs annealing), and 72 °C for 15 s (DNA extension). The last extension step at 72 °C is maintained for 3 min. the PCR product is stored at 4 °C.
    4) Detect the products of PCR amplification (agarose gel electrophoresis method), and analyze the results.
    The present invention provides an effective, accurate and reliable PCR method for the detection of bovine- and ovine/caprine-derived ingredients. And the PCR kit can be used for rapid identification of bovine- and ovine/caprine-derived ingredients, as well as able to effectively distinguish bovine-derived ingredients from ovine/caprine according to the size of amplified fragments. The method of the present invention can be applied as the standard method for detecting bovine- and ovine/caprine-derived ingredients. Thus, the PCR detection method of the present invention is rapid, sensitive, and cost-effective reliable for detecting bovine- and ovine/caprine-derived ingredients.
    BRIEF DESCRIPTION OF THE FIGUES
    Fig.l shows the detection result of bovine- and ovine/caprine-specific sequences (SEQ ID NO.l and SEQ ID NO.2) in different species.
    Fig.2 shows the sensitivity detection result of bovine- and ovine/caprine-specific sequences (SEQ ID NO. 1 and SEQ ID NO.2) using serial dilution of genome DNA as templates.
    Fig.3 shows the intra-specific conservation detection result of specific sequences (SEQ ID NO. 1 and SEQ ID NO.2) in different breeds of bovine, ovine and caprine.
    Fig.4 shows the detection results of feedstuffs samples by using the assembled PCR kit.
    DETAILED DESCRIPTION OF THE PRESENT INVENTION
    The following embodiments are used to further illustrate the present invention. But it should not be construed as a limitation of the present invention. And it is to be understood that other embodiments may be employed and that structural and logical changes may be made without departing from the scope of the present invention.
    EMBODIMENT 1: SPECIFICITY TEST
    1. Preparation and preservation of samples
    1.1 Sampling :
    Samples (> 0.2 g) were collected and stored at -20 °C.
    1.2 Preparation of DNA templates.
    DNA templates were prepared by phenol-chloroform extraction method.
    2. Designation of primer pairs
    The primer sequences of this embodiment were showed as the sequence table (SEQ ID NO.3 and 4).
    The expected amplified DNA fragment size of bovine and ovine/caprine are 125 bp and 107 bp, respectively. And their nucleotide sequences are showed as SEQ ID NO.l and SEQ ID NO.2.
    3. PCR detection
    3.1 PCR reaction of samples
    3.1.1 Reagents were sequentially added to the PCR tube (showed as Table 2), and well mixed.
    3.1.2 The PCR tube was centrifuged on a centrifuge for 10 s at 500-3000 g. Then the PCR tube was taken out and put into the PCR instrument.
    3.1.3 Conduct PCR reaction. The procedure of PCR is as follows: An initial heat denaturation step at 95 °C for 5 min, followed by 35 cycles consisting of 95 °C for 30 s (DNA denaturation), 62 °C for 30 s (primers annealing), and 72 °C for 15 s (DNA extension). The last extension step at 72 °C is maintained for 3 min. The PCR product is stored at 4 °C.
    3.1.4 After the end of the reaction, the PCR tube was taken out and the products of the reaction were detected by electrophoresis.
    3.2 PCR of the control system
    3.2.1 The PCR of blank control, negative control and positive control were performed when the samples were detected. Except for DNA template, the other components and reaction conditions of PCR were same as section 3.1 in each control systems. And the concentration of negative and positive control DNA template should also meet the requirement of PCR.
    3.2.2 The genomic DNAs of non-bovine animals (rat, mouse, hamster, guinea pig, horse, deer, donkey, pig, rabbit, fox, dog, mink, raccoon dog, chicken, duck, goose and fish) and plant species (maize and soybean) were used as the negative control DNA templates for PCR.
    3.2.3 The genomic DNAs of cattle and buffalo in Bovine, and sheep and goat in Caprine were used as the positive control DNA templates for PCR.
    3.2.4 Using sterile water as the template of blank control for PCR.
    4. Detection of PCR amplified products and determination of results.
    4.1 Agarose was weighed and added to 0.5^TBE buffer solution according to the mass concentration of 25 g/L, and then heated to clarity and transparency in microwave. After a little cooling, each 100 mL agarose solution was added with 5 pL GelRed nucleic acid dye solution and mixed evenly. Subsequently, it was poured into the electrophoresis board, and inserted into the comb board. After being solidified into gel at room temperature, put it into 0.5 TBE buffer, and gently pulled out the comb board vertically. The mixture of 5 pL PCR product and 2 pL loading buffer was added to glue hole. Meanwhile, a DNA ladder was added to one of the glue hole. The electrophoretic voltage is set at 2 V7cm~5 V/cm.
    4.2 After electrophoresis, the agarose gel was removed and placed on the gel imager or ultraviolet transmission instrument. The size of amplified bands was analyzed and judged according to the DNA marker, and the electrophoretic results were archived in electronic files or photographed with a photographic system.
    5. Result analysis and presentation: The Fig. 1 is the PCR result of blank control (lane
    1), cattle (lane 2), buffalo (lane 3), sheep (lane 4), goat (lane 5), rat (lane 6), mouse (lane 7), hamster (lane 8), guinea pig (lane 9), horse (lane 10), deer (lane 11), donkey (lane 12), pig (lane 13), chicken (lane 14), duck (lane 15), goose (lane 16), rabbit (lane 17), fox (lane 18), dog (lane 19), mink (lane 20), raccoon dog (lane 21), fish meal (lane 22), maize (lane 23) and soybean (lane 24); and M is BM2000 DNA Marker. As shown in Fig.l, there was no specific band produced in the blank control. The results showed that the specific sequences were only amplified in cattle, buffalo, sheep and goat but not in non-Bovidae species. In detailed, the specific sequences of bovine (SEQ ID NO. 1) were amplified in cattle and buffalo DNA, which size was consistent with the expected fragment (125 bp); and the specific sequences of ovine and caprine (SEQ ID NO.2) were amplified in sheep and goat, which size was consistent with the expected fragment (107 bp). This indicates that the amplified fragments are specific for bovine, ovine and caprine of Bovidae. These results indicated that the specific primer pairs of bovine and ovine/caprine have good specificity.
    EMBODIMENT 2: SENSITIVITY TEST
    The bovine or ovine/caprine genomic DNAs (20 ng, 10 ng, 2 ng, 1 ng, 0.2 ng, 0.1 ng and 0.02 ng, respectively) and sterile water (0 ng genomic DNA) were added to the 20 pL PCR system. And the specific fragments were amplified according to the optimized PCR system and conditions (same as Embodiment 1). Two technical repeats were set for each concentration sample. As shown in Fig. 2, A is the PCR result of specific primer pairs in bovine DNA, and B is the PCR result of specific primer pairs in ovine/caprine DNA. The PCR result of different concentrations of genomic DNAs, including 20 ng (lane 1-2), 10 ng (lane 3-4), 2 ng (lane 5-6), 1 ng (lane 7-8), 0.2 ng (lane 9-10), 0.1 ng (lane 11-12), 0.02 ng (lane 13-14), and 0 ng (lane 15-16), respectively; and M is BM2000 DNA Marker. The results show that there are still obvious bands when adding DNA as low as 0.1 ng in PCR, which indicates that the PCR method had good sensitivity.
    EMBODIMENT 3: INTRA-SPECIFIC CONSERVATION TEST
    The genomic DNAs of buffalo, cattle, yak, zebu, sheep (including small tailed Han sheep, Merinos sheep, Hu sheep, and Mongolian sheep), and goat (including Mongolian goat) tissues were used as the templates to amplify the specific sequences (SEQ ID NO.l and SEQ ID NO.2) according to the optimized PCR amplification system and conditions (same as Embodiment 1). The Fig.3 is the PCR result of intra-specific conservation detection of specific sequences (SEQ ID NO.l and SEQ ID NO.2) in different breeds of bovine, ovine and caprine, including buffalo (lane 1-4), cattle (lane 5-6), yak (lane 7-8), zebu (lane 9-10), small tailed Han sheep (lane 11-12), Merinos sheep (lane 13-14), Hu sheep (lane 15-16), Mongolian sheep (lane 17-18), and Mongolian goat (lane 19-20); M is BM2000 DNA Marker; E is blank control; and N is negative control (the mixture of pig and chicken genomic DNAs). The fully identical fragment (125 bp) was amplified from all the bovine DNA samples, and fully identical fragment (107 bp) was amplified from all the ovine/caprine DNA samples. This indicates that the primer pairs and the specific DNA sequence are fairly conservative for the different breeds and individuals of bovine and ovine/caprine, respectively.
    EMBODIMENT 4: KIT COMPOSITION
    The kit consists of:
    Table 3 The composition of PCR kit for the detection of bovine- and ovine/caprine-derived ingredients
    CompositionPreservation temperature100 timessterile waterroom temperature1500 pLTaq enzyme-20 °C15 pL10* PCR Buffer-20 °C1000 pLdNTP Mixture-20 °C1000 pLForward primer-20 °C500 pLReverse primer-20 °C500 pLpositive control of bovine-20 °C500 pLpositive control of ovine/caprine-20 °C500 pL
    The kit components are guaranteed for at least to 12 months when stored at -20 °C.
    Application of kit:
    1) Sampling according to the PCR reaction system described in Table 2 as required.
    2) The PCR reaction is performed according to the conditions of PCR amplification described in 3.1.3 of Embodiment 1.
    3) After PCR, the 5 pL PCR products are obtained and dyeing with GelRed, and then electrophoresis in 25 g/L agarose gel with 2 V/cm~5 V/cm for 30-60 min. The result is detected in gel imaging system. At the same time, the blank control and positive control are set in each PCR reaction, which reaction system and amplification condition are same as the samples.
    EMBODIMENT 5: DETECTION OF FEEDSTUFF SAMPLES
    The genomic DNAs of 5 feedstuffs samples were obtained for PCR detection according to the optimized PCR amplification system and conditions (same as Embodiment 1).
    Fig.4 shows the PCR result of bovine (lane 1), ovine/caprine (lane 2), and feedstuff samples (lane 3-7); M is BM2000 DNA Marker; E is blank control; and N is negative control (the mixture of pig and chicken genomic DNAs). The results indicate that the specific fragments were amplified in the NO.3-6 feedstuffs samples. In details, the bovine- and ovine/caprine-derived ingredients were detected in the NO.3 sample; the bovine-derived ingredients were detected in the NO.4 sample; and ovine/caprinederived ingredients were detected in the NO.5&6 samples. The specific fragment was not amplified in the negative No.7 sample (the main ingredients were fishmeal and plant ingredients). And there were no amplified fragments in the negative control or the blank control. All the detection results are consistent with the expected results.
    Conclusion:
    The species-specific primer pairs are designed in the intra-species conserved and inter-species hyper variable regions of TAF4 gene, which were used to specifically detect bovine- and ovine/caprine-derived ingredients in feedstuffs and foods. The sizes of amplified fragments are designed as different length for bovine (125 bp) and ovine/caprine (107 bp), which could distinguish bovine form ovine/caprine in one PCR reaction. Furthermore, the primer can detect different breeds of bovine (cattle, buffalo, yak and zebu) and ovine/caprine (sheep and goat) at will, which could avoid false negative results. Thus, the PCR kit including the species-specific primer pairs can conveniently detect bovine- and ovine/caprine-derived ingredients forbidden in ruminant feedstuffs with 0.1 ng DNA sensitivity, which provide an excellent approach in food supervision and market management department.
    SEQUENCE DESCRIPTION:
    SEQ ID NO.l is the nucleotide sequence amplified specifically from bovine genomic DNA, which size is 125 bp;
    SEQ ID NO.2 is the nucleotide sequence amplified specifically from ovine/caprine genomic DNA, which size is 107 bp;
    SEQ ID NO.3 is the sequence of forward primer amplifying the specific nucleotide sequence of bovine and ovine/caprine;
    SEQ ID NO.4 is the sequence of reverse primer amplifying the specific nucleotide sequence of bovine and ovine/caprine.
    Sequence list
    SEQ ID NO. 1 atggcttagg acccagctct gcagccatgg ttcggggcct tgagcttccc aggtgtgcag 60 ctgctgatgg tggattggca ctgatccggg tggtgtggtg tggttccgat ccaggttctg120 gttgt125
    SEQ ID NO.2 atggcttagg acccagctct gcagccatgg tttggggcct ggagattccc aggtttgcag 60 ctgctgatgg tggattggtg tgtggttccg atccaggttc tggctgt107
    SEQ ID NO. 3 atggcttagg acccagctct
    SEQ ID NO.4 acarccagaa cctggatcgg a
    List of references
    Species-specific PCR for the identification of ruminant species in feedstuffs [J], Meat Science, 2007, 75(1):120-127.
    Prado M , Berben G, Fumière, Olivier, et al. Detection of Ruminant Meat and Bone Meals in Animal Feed by Real-Time Polymerase Chain Reaction: Result of an Interlab oratory Study[J], Journal of Agricultural and Food Chemistry, 2007, 55(18):7495-7501.
    Safdar M , Junejo Y , Arman K , et al. Rapid Bovine and Caprine species Identification in Ruminant Feeds by Duplex Real-Time PCR Melting Curve Analysis Using EvaGreen Fluorescence Dye[J], Molecular Biotechnology, 2014, 56(8):770-776.
    Martin I, Garcia T, Fajardo V , et al. Real-time PCR for quantitative detection of bovine tissues in food and feed[J], Journal of Food Protection, 2008, 71(3):564.
    Safdar M , Junejo Y . A multiplex-conventional PCR assay for bovine, ovine, caprine and fish species identification in feedstuffs: Highly sensitive and specific[J], Food Control, 2015, 50:190-194.
    Safdar M , Junejo Y . Development and validation of fast duplex real-time PCR assays based on SYBER Green florescence for detection of bovine and poultry origins in feedstuffs[J], Food Chemistry, 2015, 173:660-664.
    Lee J H , Kim M R, Jo C H, et al. Specific PCR assays to determine bovine, porcine, fish and plant origin of gelatin capsules of dietary supplements!J], Food Chemistry, 2016, 211:253259.
    权利要求:
    Claims (2)
    [1]
    CONCLUSIONS
    A pair of primers specific to cattle and sheep / goats that are capable of amplifying the nucleotide sequences shown by SEQ ID NO: 1 and SEQ ID NO: 2.
    The primers of claim 1, wherein the nucleotide sequence shown by SEQ ID NO: 1 is a bovine specific genomic sequence and the nucleotide sequence represented by SEQ ID NO: 2 is a sheep / goat specific genome sequence.
    The primers of claim 1 or 2, wherein the sequences of the primers are shown as follows:
    Forward primer: ATGGCTTAGGACCCAGCTCT -3 '(SEQ ID NO: 3); and
    Reverse primer: ACAR1CCAGAACCTGGATCGGA -3 '(SEQ ID NO: 4).
    A detection kit comprising the primers of any one of claims 1-3.
    The detection kit of claim 4, further comprising one or more selected reagents from Taq enzyme, dNTPs, MgCb, PCR buffer, DNA template as positive control, and a blank control.
    Detection kit according to claim 5, wherein the DNA template as a positive control is genomic DNA from cattle and sheep / goats, and the blank control is sterile water.
    Use of the primers according to any of claims 1-3, and the detection kit according to any of claims 4-6 for identification of ingredients derived from cattle or sheep / goats.
    A PCR method for detecting bovine or sheep / goat ingredients in a sample, comprising the following steps:
    (1) extracting genomic DNA from a sample;
    [2]
    (2) PCR amplification using the primers of any one of claims 1-3, with the genomic DNA of bovine and sheep / goats as a positive control, and the sterile water as a blank control;
    and (3) analysis of the PCR amplification products of step (2).
    1/2
    4 5 6 7 8 9 1G 11.12 13 14 15, 16 17 18
    19. '20. 21 22 23 24
    125 bp ®ΙΒ ·
    类似技术:
    公开号 | 公开日 | 专利标题
    Kumar et al.2015|Identification of species origin of meat and meat products on the DNA basis: a review
    KR101318311B1|2013-10-15|A method for identifying a pork content in a food
    Ilhak et al.2007|Identification of meat species by polymerase chain reaction | technique
    Alikord et al.2018|Species identification and animal authentication in meat products: a review
    Cawthraw et al.2009|Real-time PCR detection and identification of prohibited mammalian and avian material in animal feeds
    Sul et al.2019|Development of a direct loop-mediated isothermal amplification | assay for rapid and simple on-site detection of chicken in processed meat products
    ÖZPINAR et al.2013|Detection of animal species in some meat and meat products by comparatively using DNA microarray and real time PCR methods
    KR101296221B1|2013-08-13|Method of identifying animal species using polymerase chain reaction
    Pegels et al.2014|Avian-specific real-time PCR assay for authenticity control in farm animal feeds and pet foods
    Hsieh et al.2016|Detection of undeclared animal by‐products in commercial canine canned foods: Comparative analyses by ELISA and PCR‐RFLP coupled with slab gel electrophoresis or capillary gel electrophoresis
    US20090170107A1|2009-07-02|Detection assay for meat and bone meal in feed
    Wu et al.2018|Species identification of fox-, mink-, dog-, and rabbit-derived ingredients by multiplex PCR and real-time PCR assay
    Fontanesi2017|Meat authenticity and traceability
    KR101209786B1|2012-12-07|PCR or real-time PCR primers for identification of animal species, the kit comprising the primers, and the method for identifying animal species using the primers or kits
    Krcmar et al.2005|Quantitative detection of species-specific DNA in feedstuffs and fish meals
    Vaithiyanathan et al.2016|Species identification of cattle and buffalo fat through PCR assay
    NL2024167B1|2020-05-01|A pcr kit for the detection of bovine and ovine/caprine derived ingredients
    CN107012247B|2020-01-10|Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene
    CN106995852B|2020-08-11|Real-time fluorescence PCR detection method for detecting sheep-derived components in food and feed by using single-copy nuclear gene
    CN107541566B|2021-04-23|Method and kit for detecting mammal and bird animal derived components
    Tisza et al.2016|Identification of poultry species using polymerase chain reaction-single strand conformation polymorphism | and capillary electrophoresis-single strand conformation polymorphism | methods
    Chen et al.2019|A novel multiplex xMAP assay for generic detection of avian, fish, and ruminant DNA in feed and feedstuffs
    Csikos et al.2016|Applicability and sensitivity of PCR-SSCP method for milk species identification in cheese
    CN108330168B|2021-08-17|Primer combination for synchronously detecting 14 animal-derived components in meat or meat product and application thereof
    CN104894263A|2015-09-09|Multiple-species-component real-time fluorescence PCR | combined detection method
    同族专利:
    公开号 | 公开日
    CN110144346A|2019-08-20|
    NL2024167B1|2020-05-01|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    CN201811617810|2018-12-28|
    [返回顶部]